| Anthr 1... | ||||||||||||||||||||||||
| Course Outline | ||||||||||||||||||||||||
|
|
Anthropology 1 K.Irvine Spring 1999 M&W Office 16-17 Mon12-2 COURSE SYLLABUS This is a transferable parallel college course which meets the general education requirement in the biological sciences at CSU or UC. To maintain its transferability this course has the same rigor, depth and breadth in its assignments, reading, and grading as a parallel CSU or UC course in physical or biological anthropology. COURSE OBJECTIVES AND GOALS To understand: 1. The controversies associated with evolution. 2. The production of physical variation through genetic inheritance. 3. The evolution of variation in populations through mutation, selection, random drift and gene flow. 4. The classification of primates (prosimians, monkeys, and apes), their anatomy, and behavior. 5. The fossil record of primate evolution from archaic prosimians to modern apes. 6. The fossil record of hominid evolution from Australopithecus through Homo habilis, Homo erectus, Archaic Homo sapiens to Modern Homo sapiens. 7. The methods of paleoanthropology used in interpreting the hominid fossil record through the use of Geo.-chemical dating techniques, archaeology, and forensics ( skeletal identification). 8. The distribution and adaptation of modern humans and the inappropriateness of the concept of "race". REQUIRED TEXTS Angeloni: Physical Anthropology 98/99 Boyd&Silk: How Humans Evolved REQUIREMENTS 1.Four examinations over class and all texts: Scantron 882, 400 points. 2.Comprehensive final examination, 100 points. Mandatory no exceptions. 3.Written assignments from class exercises 100 points and class discussions 4.To be prepared for weekly discussions from 98/99 reader including bringing reader to class 100 points. 5. Internet access for required assignments 100 points. 5 Make up exam last class meeting. 6.Attendance and promptness: It is expected. Leaving class early is an absence. Absences may lead to being dropped. This is done on a case by case basis. 7.Participation:Active and attentive participation is expected, this includes discussions and attendance. Persistence in non participation will lead to student being asked to leave class for the period. 8. There is no individual extra credit but optional assignments may be announced. GRADING A=90% of total points 810-900 points B=80% of total points 720-809 points C=70% of total points 630-719 points D=60% of total points 540-629 points CLASS POLICY 1. Exams are given in a collaborative format except the makeup exam. 2-5 persons per group. Each member has her own scantron. To be eligible to take the exam with your group you must be present at the prior class meeting when the group puts together its study sheet and you must arrive on time for the exam. At the end of the semester members of each group will evaluate members' participation. This may affect exam scores. Scantron scores will not be changed due to erasure errors, please erase very carefully and thoroughly. 2. To receive full credit for 98/99 reader discussions you must be present in class and on time. There is no credit for absences regardless of reason. If you are present but not prepared for the class discussion you will be asked to leave class until the discussion is finished. 3. The copying of answers to the 98/99 questions, homework, and class exercises is plagiarism and may result in a 0 credit for both parties for the assignment. A consistent pattern of such behavior shall lead to an F gradefor the course. 4. The final exam is a collaborative project presented to the class in a display or poster board format. Grading will include member evaluation of participation in the project. Non participation in the final exam project or absence at the final exam period shall result in an F grade for the course. EXAM SCHEDULE (Packet of class work,98/99reader answers& internet reponse copies due on each day) Boyd&Silk Exam Date l Ch.1,2,3,4 Feb 8 ll Ch. 5,6,7&19,8&18 Mar 8 lll Ch. 9,10,11,12 April 12 lV Ch.13,14,15,16,17 May 10 Make Ups May 12 Final Examination Mon. May 17 at 8!! DISCUSSION SCHEDULE FROM 98/99 READER ALL DISCUSSIONS ARE ON WEDNESDAYS Week Reading fron Angeloni 1 1 2 38&39 3 40&41 4 2&4 5 7&8 6 9&10 7 12&13 8 14&17 9 5&11 10 18&19 11 20 12 22&30 13 21&23 14 24&25 15 26&27 16 33&34 Come to class with the 98/99 book and questions over the reading answered. questions may be found with the class workbook for the unit.Answers are turned in on exam day. INTERNET ASSIGNMENTS Immediately obtain access to the Internet and an E mail account Then: 1. Use the password that comes with Boyd&Silk and register with the publisher.This site will be used in April &May. Make sure that your password is good until May 10, if not exchange your book at the bookstore immediately! 2.Join our 2 Yahho clubs: http://clubs.yahoo.com/clubs/biologicalanthropology http://clubs.yahoo.com/clubs/humanevolution Weekly Assignments: there are 2 for each week 1. Internet homework can be found at biological anthropology club site for each week of the course. Post you answers there as a response by Sunday midnight. 2. Discussion question is posted for each week at the human evolution club. Post your opinion as a response by Sunday midnight. Keep printed copies of your reponses and turn in on exam day. | |||||||||||||||||||||||
| 98/99 Reader Unit 1 | ||||||||||||||||||||||||
|
|
I will be moving my belongings in shortly. In the meantime why not check out the link below to get your own 20MB of free webspace? Weeks 1-4 98/99 Reader Name______________________ #1. THE GROWTH OF EVOLUTIONARY SCIENCE, DOUGLAS J. FUTUYMA KEY TERMS AND TOPICS THE ORIGIN OF SPECIES -- the book in which Charles Darwin published his theory of evolution. CRITICAL ANALYSIS Multiple Choice Questions 1. The French naturalist Buffon, according to "The Growth of Evolutionary Science," speculated on the possibility of: a. fossils as remnants of the biblical deluge. b. cosmic and organic evolution. c. the "great chain of being," or scala naturae. d. "final causes." 2. The evolutionary challenge to the view that the earth and the heavens were immutable, changeless, as noted in "The Growth of Evolutionary Science," began in: a. astronomy. b. philosophy. c. astrology. d. geology. 3. Natural selection, as maintained in "The Growth of Evolutionary Science," fell into particular disrepute in the early part of the twentieth century, because of the rise of: a. theology. b. ecology. c. anthropology. d. genetics. 4. Natural selection, as stated in "The Growth of Evolutionary Science," is the antithesis, or opposite, of: a. transformation. b. variation. c. randomness. d. science. True/False Questions 5. All genetic changes in species, as suggested in "The Growth of Evolutionary Science," must be adaptive. 6. Georges Cuvier, the foremost paleontologist and anatomist of his time, as claimed in "The Growth of Evolutionary Science," was an influential proponent of evolution. GENERAL QUESTIONS 7. Briefly discuss Charles Darwin's view of evolution, as outlined in "The Growth of Evolutionary Science." 8. Explain the theory of the so-called catastrophists, as discussed in "The Growth of Evolutionary Science." 38. EUGENICS AND AMERICAN SOCIAL HISTORY, 1880-1950, GARLAND E. ALLEN CRITICAL ANALYSIS Multiple-Choice Questions 1. According to "Eugenics and American Social History, 1880 1950�, there was a close affinity between eugenics and the pro gressive return movement around the turn of the century, be cause: a. it was an era of economic instability and social turbulence. b. a new group of professional experts was making a name for itself in American business and governmental life. c. eugenicists and Progressives believed that modern society must function on a completely laissez-faire principle. d. both groups viewed nature and nurture as two sides of the same coin. 2. The passage of the John Act (Immigration Restriction Act) of 1924, as noted in "Eugenics and American Social History, 1880 1950, � selectively restricted immigratlon from all ot the followlng countries except: a. Mediterranean. b. Eastern Europe. c. African. d. Central Europe. 3. In the period between World Wars I and ll, as cited in �Eugenics snd American Social History, 1880-1950," the fastest-growing field of modern biological research was: a. heredity. b. genetics. c. infertility. d. birth defects. True/False Questions 4. In the 1880s and 1890s, as claimed in "Eugenics and American Social History, 1880-1950:' the fit of society, the wealthy and powerful, showed a rising birthrate. 5. Eugenicists and their wealthy supporters, as reported in �Eu genics and American Social History, 1880-1950," shared a mu tual antipathy for political radicalism and class struggle. GENERAL QUESTlONS 6. As discussed in �Eugenics and American Soclal History, 1880 1950, what has always been important among the justifications for social practices? 7. As outlined in "Eugenics and American Social History, 1880 1950," what gave the eugenics movement the coherence it did have? 39. EUGENICS REVISITED, JOHN HORGAN KEY TERMS AND TOPICS Eugenics from Greek for "good birth"; refers to a controlled form of breeding. Heritability a term that represents the degree to which a trait stems from genetic bctors. Polymorphisms certain stretches of human DNA. Marker a polymorphism that merely lies near a gene. Phenylketonuria a genetic disease that causes profound re tardation. Hypothalamus a region of the brain known to control sexual response. CRITICAL ANALYSIS Multiple-Choice Ouestions 1. Regardless of the ongoing debate over the validity of eugenics, according to "Eugenics Revisited �,its revival is a response to: a. society becoming increasingly more Intolerant of people born� different." b. the astounding successes of biologists in mapping and ma nipulating the human genome. c. the increasing number of people born with serlous mental and physical disorders. d. the new policy of Insurance companies requlring potential clients to take a battery of tests prior to offering coverage. 2. The ostensible purpose of investlgations of mental Illness, also holism, and even crlme, as maintained in �Eugenlcs Revisited," Is to: a. encourage tolerance. b. find treatments. c. reduce their incidence. d. test whether they are innate. 3. Somewhere on chromosome 4, as noted in "Eugenics Revis lted,' was found the llnkage to the gene for: a. alcoholism. b. schizophrenia. c. cystic fibrosis. d. Huntington's disease. 4. The term that represents the degree to which a trait stems from genetic factors, as identified in "Eugenics Revisited,is: a. heritability. b. polymorphism. c. eugenics. d. monozygotic. True/False Questions 5. Twin studies, as suggested in �Eugenlcs Revlslted,� indicate which specific genes contribute to a trait. 6. Schizophrenia and manic depression, according to �Eugenics Revisited," are caused by psychosocial factors. GENERAL QUESTlONS 7. Briefly explaln what Slmon LeVay's claim is regarding homosex uality, as examined In "Eugenics Revisited." 8. How does William Byne account for the increased concordance for homosexuality among identical twins? #40. THE DNA WARS, EDWARD HUMES KEY TERMS AND TOPICS GENETIC PRINTING -- a technique for identifying criminals through their DNA. VNTR -- a fragment of DNA that links parts of the DNA together; this is the section studied in DNA printing. AUTORAD -- an autoradiograph, or a picture of the VNTR pattern used in DNA printing. CRITICAL ANALYSIS Multiple Choice Questions 1. As detailed in "The DNA Wars," DNA typing has been challenged because: a. it is totally unreliable. b. many people have identical DNA structures. c. blurry DNA prints can be interpreted in different ways. d. more sophisticated tests are now common. 2. As noted in "The DNA Wars," it is possible that DNA typing may actually be less reliable than: a. reports of eyewitnesses. b. fingerprinting. c. ordinary blood typing. d. computerized forensic recreations. 3. The Frye Rule, according to "The DNA Wars," states that new scientific evidence is admissible in court only when: a. there is no substantial debate about the scientific discovery in the relevant scientific community. b. there is no circumstantial evidence to support a case. c. the majority of published reports support the scientific validity of the new evidence. d. both the prosecution and the defense agree to admit it. 4. In the case described in "The DNA Wars," Professor Laurence Mueller's testimony was challenged on all of the following points except: a. the amount of money he was paid as an expert witness. b. his academic background and training. c. his use of experiments with fruit flies to draw conclusions about human genetics. d. the prosecution charged him with deliberately making erroneous conclusions based on false data. True/False Questions 5. As described in "The DNA Wars," the autorad created by VNTR patterns is similar to a grocery store bar code label. 6. According to "The DNA Wars," the Supreme Court has agreed to hear the appeal in the Joseph O'Dell case, so a ruling on the validity of using DNA printing may soon be forthcoming. GENERAL QUESTIONS 7. As stated in "The DNA Wars," what specific questions about using DNA printing are raised by the case of David Hicks? 8. What are some of the tactics, as detailed in "The DNA Wars," that have been used against scientists who have challenged DNA printing's accuracy? #41 Dr. Darwin, Lori Oliwenstein 1. The evolutionary concept that is being applied to disease is: a. variation through mutation b. natural selection c. genetic drift d gene flow 2. For a virus to survive it must be: a. lethal b. easily transmitted c. not able to survive outside the host d. fast acting 3. Since the Sone Age we: a. get less exercise b. have more menstrual cycles c. use our eyes for close up work d. all of the above True or False 4. Diarrhea should be treated because its an important part of serious dieases. 5. In its mild form sickle cell disease provides protection against malaria. General Questions 6. Explain how by treating symtoms of diseases we might be prolonging the disease. 7. Describe the new discipline of Darwinian medicine. #2. CURSE AND BLESSING OF THE GHETTO, JARED DIAMOND KEY TERMS AND TOPICS G-M2 GANGLIOSIDE -- the excessive accumulation in nerve cells of a fatty substance. CRITICAL ANALYSIS Multiple Choice Questions 1. The enzyme absent in Tay-Sachs children, according to "Curse and Blessing of the Ghetto," is coded for by a piece of: a. microbe. b. lysosome. c. DNA. d. protein. 2. Of the 13 million Jews alive today, as noted in "Curse and Blessing of the Ghetto," more than three quarters are: a. Ashkenazim. b. Sephardim. c. Oriental. d. Mediterranean. 3. Of the following, the ethnic group at highest risk for diabetes, as stated in "Curse and Blessing of the Ghetto," is: a. European whites. b. Pacific Islanders. c. Eastern European Jews. d. African blacks. True/False Questions 4. To get Tay-Sachs, as claimed in "Curse and Blessing of the Ghetto," a child must inherit a defective gene from just one parent. 5. Eastern European Jews, according to "Curse and Blessing of the Ghetto," were primarily peasant farmers living in the countryside. GENERAL QUESTIONS 6. What is the cause of Tay-Sachs, as explained in "Curse and Blessing of the Ghetto"? 7. Describe the progress of Tay-Sachs disease, as outlined in "Curse and Blessing of the Ghetto." #3. THE SALTSHAKER'S CURSE, JARED DIAMOND CRITICAL ANALYSIS Multiple Choice Questions 1. Around the world, according to "The Saltshaker's Curse," the only people who exceed U.S. blacks in their risk of dying from stroke are the: a. New Guinea highlanders. b. Brazilians. c. Japanese. d. Australian Aborigines. 2. Sickle cell anemia, as noted in "The Saltshaker's Curse," evolved in certain regions as a resistance against: a. malaria. b. tuberculosis. c. polio. d. diabetes. 3. Black slavery in the Americas, as pointed out in "The Saltshaker's Curse," began about 1517, with the first imports of slaves from: a. Southeast Asia. b. North Africa and the Middle East. c. East Africa. d. West Africa. True/False Questions 4. Salt, as claimed in "The Saltshaker's Curse," has been in very short supply for much of recent human evolutionary history. 5. As suggested in "The Saltshaker's Curse," there is no genetic component in essential hypertension. GENERAL QUESTIONS 6. List the environmental or lifestyle factors contributing to the risk of hypertension that have been identified by epidemiological studies, as stated in "The Saltshaker's Curse." 7. What are two possible evolutionary explanations for salt retention by New World blacks, as speculated in "The Saltshaker's Curse"? | |||||||||||||||||||||||
| Class Work Sheets | ||||||||||||||||||||||||
|
| Class Work Sheets Unit 1 QUESTION 1 The assumptions of religion and science are different. Listed below are the assumtions or bases of religion. Fill in the science assumptions. RELIGIOUS SCIENTIFIC TRUTH TRUTH Mystical __________ Supernatural __________ Sacred __________ Absolute __________ Faith __________ Revealed __________ QUESTION 2 Based on these assumptions read the following and ascertain whether they are religious or science texts. Circle those words that are distinguishing in distinguishing religion from science. 1 Chance, luck, coincidence, miracle. One of the main topics of this chapter is miracles and what we mean by them. My thesis will be that events that we commonly call miracles are not supernatural, but are part of a spectrum of more-or-less improbable natural events. A mir acle, in other words, if it occurs at all, is a tremendous stroke of luck. Events don't fall neatly into natural events versus miracles. There are some would-be events that are too improbable to be contemplated, but we can't know this until we have done a calculation. And to do the calculation, we must know how much time was available, more generally how many opportunities were available, for the event to occur. Given infinite time, or infinite opportunities, anything is possible. The large numbers proverbially furnished by astronomy, and the large time spans characteristic of geology, combine to turn topsy-turvy our everyday estimates of what is expected and what is miraculous. I shall build up to this point using a specific example which is the other main theme of this chapter. This example is the problem of how life originated on Earth. To make the point clearly, I shall arbitrarily concentrate on one particular theory of the origin of life, although any one of the modern theories would have served the purpose. We can accept a certain amount of luck in our explanations, but not too much. The question is, how much? The immensity of geological time entitles us to postulate more improbable coincidences than a court of law would allow but, even so, there are limits. Cumulative selection is the key to all our modern explanations of life. It strings a series of acceptably lucky events (random mutations) together in a non random sequence so that, at the end of the sequence, the finished 2 Since God, who created time as well as space, knows the end from the beginning, His ultimate purpose in creation must be centered on these eternal ages to come and on man's role in these future ages. Since He did not immediately proceed to such a future economy right from the beginning, however, we must conclude that this present economy is tentative and probationary and that this phase also involves good and sufficient reasons on God's part. The need for a period of probationary service clearly suggests the need for a time of testing and training. As beings created in God's image, men and women are not robots, capable of doing only what they are designed and commanded to do. Neither are they infinite in wisdom and ability, for then they would be not in God's image, but as God Himself. They were freely responsible for what they might do, yet not yet ready for all God had ultimately planned for them to do. Thus the need for a time of preparation and probation. Furthermore, God chose not to create a whole population of people directly, but indirectly, through the marvelous process of reproduction. Adam was "the first man" (I Cor. 15:45) and Eve was "the mother of all living" (Gen. 3:20), and it would take thousands of years before an adequate number of people could be produced and prepared for God's eternal plan. QUESTION 3 The following are creationists claims disproving evolution. Following these claims is the list of rebuttals from science. They are out of order. Match letter from the rebuttal with the appropriate claim. 1. Evolution violates the second law of thermodynamics. 2. The small amount of helium in the atmosphere proves the Earth is young. 3. The rate of decay of the Earth's magnetism indicates the Earth is 10,000 years old. 4. There are no transitional fossils. 5. Fossils appear out of nowhere at the base of the Cambrian. 6. All fossils were deposited at the time of Noah and the Flood. 7. There are places where advanced fossils lie below more primitive fossils. 8. The chances of molecules becoming a living cell are very small. 9. Dinosaur and human footprints have been found together in Texas. 10. Biologists have never seen a species evolve. 11. Evolution too is a religion. 12. A living fresh water mussel was dated to be 2,000 years old. 13. Prominent biologists have disputed evolution. a.This is a Fred Flintstone version of prehistory. The "man tracks" seen by creationists stem from two sources. One is wish ful imagination, whereby water-worn scour marks and eroded dinosaur tracks are perceived as human footprints. The other source is deliberate fraud. Creationist hoaxers obscure the foot pads of dinosaur tracks with sand and photograph what re mains, the dinosaur's toe impressions. When reversed, the tip of the dinosaur toe or claw becomes the heel of a "human" print. In addition to doctored dinosaur tracks, there are other hoaxed prints cir culating in this area of Texas. . b.The Earth's magnetic field does indeed decay, but it does so cyclically, every few thousand years, and it is constantly being renewed by the motion of the liquid core of the Earth. c.These statements conveniently ignore the fact that you can get order out of disorder if you add energy. For example, an un assembled bicycle that arrives at your house in a shipping carton is in a state of disorder. You supply the energy of your muscles (which you get from food that came ultimately from sunlight) to assemble the bike. You have got order from disorder by supply ing energy. Just as the more structured oak tree is derived from the less complex acorn by the addition of energy captured by the growing tree from the Sun, so sunlight, via photosynthesis, provides the energy input that propels evo lution. d. There is not a shred of evidence in the geological record to support the claim of a single, worldwide flood. Geological for mations such as mountain ranges and the Grand Canyon require millions of years to form, and the fossil record extends over sev eral billion years. The time required for continents to have drifted into their present positions is immense. These things cannot be accounted for by a single flood lasting a few days or years. e. Helium, used to suspend blimps in air, is a very light gas and simply escapes into space; like hydrogen, it cannot accumulate in Earth's atmosphere to any great extent. f. Earth movements such as faulting and thrusting produce these discontinuities; the older rock has simply been pushed over on top of the younger rocks, as we sometimes see even along iugh way cuts. These places are easily recognized and explained by geologists. g. Simulation experiments have repeatedly shown that amino acids do not assemble randomly. Their molecular structure causes them to be self-ordering, which enhances the chances of forming long chains of molecules. Simulation experiments also demonstrate that the formation of prebiotic macromolecules is both easy and likely and does not require DNA, which is a later step in the evolution of proteins. The stepwise application of cumulative natural selection acting over long periods of time can make the improbable very likely. h.On a small scale, we certainly have. Using allopolyploidy and artificial selection, scientists have manufactured crop plants and horticultural novelties that are reproductively isolated from the parental stock. In addition, one can see stages of incipient speciation in nature by looking at clinal variations and subspecies, that is, gradual change in the characteristics of a population across its geographical range. i.Not so. Biologists do not have to believe that there are transitional fossils; we can examine them in hundreds of museums around the world, and we make new discoveries in the rocks all the time. Scientists do not have to believe that the solar system is 4.5 billion years old; we can test the age of Earth, Moon, and meteoritic rocks very accurately. We do not have to believe that protocells can be easily created from simple chemicals in the laboratory; we can repeat the ex periments, with comparable results. We can also create artificial species of plants and animals by applying selection, and we can observe natural speciation in action. Science exists because of the evidence. j.There are many transitional fossils, including the ape-human transitional form, Australopithecus. Eusthenopteron shows mar velous intermediate characteristics between the lobe-finned fishes and the amphibians. The transitional fossils between am phibians and reptiles are so various and so intermediate that it is difficult to define where one group ends and the other begins. Archaeopteryx is clearly intermediate between reptiles and birds k. The earliest micro fossils date back, in fact, to the Precambrian, about 3.5 billion years ago. A variety of multicellular life ap pears in the fossil record about 670 million years ago, which is 80 million years before the Cambrian. The Cambrian does seem to explode with fossils, but that is simply because the first shelled organisms, such as the brachiopods and the trilobites, date from the Cambrian; their resistant shells fossilize far more readily than their soft-bodied ancestors of the Precambrian. l. When used properly, Carbon 14 is a very accurate time-mea suring technique. The mussel in this example is an inappropriate case for 14C dating because the animal had acquired much of its carbon from the limestone of the surrounding water and sedi ment. The 14C technique has no such problems with the tree branch that gets its carbon from the air, or with the campfire sites of ancient peoples. QUESTION 4 The chromosome number for each species is constant but varies from species to species. The chromosome numbers for several species of primates are provided. Enter the number of chromosomes that will be passed from one parent to the next generation for that species. Primate Chromosome Number Number from parent 1 Wooly monkey 62 ________ 2 Spider monkey 34 ________ 3 Rhesus monkey 42 ________ 4 Baboon 42 ________ 5 Gorilla 48 ________ 6 Chimpanzee 48 ________ 7 Human 46 ________ QUESTION 5 Each parental gamete or sex cell contains half the species number of chromosomes. How many different kinds of gametes can be produce by each parent? Chromosome Chromosome Calculation Number number number pair of gamete varieties 1 2 1 2 2 2 4 2 2 4 3 6 3 2 8 8 __ __ __ 12 __ __ __ 24 __ __ __ 46 __ __ __ When there are more chromosomes in the species there is less or more variation? QUESTION 6 PTC (phenyl-thio-carbide) is a human -made approximation of a naturally occuring chemical. The ability to taste this chemical is inherited as a dominant characteristic (T). The inability to taste PTC is inherited as a recessive characteristic (t). PTC is found in turnips, kale, and brussel sprouts which has a bitter taste. Persons who can taste this chemical are apt to reject these foods and are, therefore, less susceptible to goiter disease. What kinds of gametes can the following I ndividuals produce? Genotype Phenotype Kinds of gametes TT taster __________ Tt taster __________ tt nontaster __________ QUESTION 7 Determine the possible offspring genotypes and phenotypes produced from the following matings. Mating Offspring genotype Offspring phenotype Tt x Tt ________________ __________________ TT x tt ________________ _________________ Tt x TT________________ __________________ QUESTION 8 The ABO blood group system is a multiple allele system. The genes for A and B produce antigens or proteins A or B. They are dominants. The O allele produces no antigen and is inherited as a recessive gene. Determine the possible genotypes and and phenotypes produced from the following matings. Mating Offspring genotype Offspring phenotype AA x AB ________________ _________________ AO x BO ________________ _________________ AB x AB ________________ ________________ OO x BO ________________ ________________ QUESTION 9 Normal hemoglobin or red blood is a protein whose function is to carry oxygen. This phenotype is determined by a dominant gene Hb A. A mutant gene Hb S, also a dominant will produce hardened sickle like hemoglobin. The heterozygous genotype (AS) produces both normal and abnormal hemoglobin or sickle cell trait. The homozygous genotype (SS) yields sickle cell anemia disease which may be fatal. Determine the possible genotypes and phenotypes produced from the following matings. Mating Offspring genotype Offspring phenotype AA x AS ________________ _________________ AS x AS ________________ _________________ QUESTION 10 The following is a portion of DNA. AAACATTTTGACCCCAATCAG TTTGTAAAACTGGGGTTAGTC How many nucleotide pairs are present? How many triplet pairs are present? QUESTION 11 The following is a portion of DNA. Below write the complimentary strand. CATAAAGAGCTATAG QUESTION 12 The following is a strand of DNA. In the places below write in what the strand may look like if it is subject to the kind of mutation listed. CTAGAGTAGCATGGGATT Substitution Addition Deletion Transposition 4 Exercises and Problems QUESTION 13 Reading Gene Frequencies:Origin of Populations It has been hypothesized that the reindeer herders of Northern Europe did not originate there but migrated west from Asia.Do the gene frequencies support the migration hypothesis? Gene N.Europeans Lapps Asians A .49 .51 .20 B .10 .02 .25 O .41 .47 .55 HINT:gene frequencies of migrants should bear some resemblance to frequencies from where they came. QUESTION 14 It has been hypothesized that the Hungarian Gypsies originally came from India.Do the gene frequencies support the migration hypothesis? Gene Hungarians Gypsies Indians A .44 .24 .23 B .24 .42 .45 O .31 .34 .31 QUESTION 15 African,Asian, and Oceanic Pygmy or Negrito peoples are genetic interrelated populations all originally from Africa.Do the gene frequecies support the common origin hypothesis? Gene African Asian Oceanic A .20 .54 .08 B .25 .08 .14 O .55 .38 .79 __________________________________________ M .47 .61 .10 N .52 .39 .90 QUESTION 16 Evaluating evolutionary forcesSardinia is a mountainous island off the coast of Italy.The f gene for the fatal Cooley's anemia or Thalassemia is present in varying frequencies among the villages. Altit ude Village Gene Frequency 2400'-3000' village E .04 1800'-2400' village D .12 1200'-1800' village C .17 600'-1200' village B .23 0'- 600' village A .23 Why do the gene frequencies for this fatal gene diminish as you ascend the mountain? QUESTION 17 Among the Amish of Pennsylvannia there have been88 reported cases of a rare recessive six-fingered dwarfism.In the rest of the United States there have been only 49 reported cases.Why is their such an abnormally high incidence for the Amish? QUESTION 18 Among the San Blas Indians of tropical Panama there exists the highest percentage of albinos of any known population in the world.The gene frequency is .03 elsewhere it is as rare as to be almost 0.Why is it so high among these Indians? QUESTION 19 Gene flow is the migration of genes from one population to another.Comparing gene frequencies among populations.Looking atthe following gene frequencies asses the hypothesis that there has been little or no gene flow from the recent white residents of Montana to the aboriginal inhabitants the Blackfeet Indians. Gene Amer. Indians Blackfoot Recent Arrivals A 00-.10 .04 .55 B .00 .00 .09 O .90-1.00 .96 .46 QUESTION 20 The Dunkers are a religious sect who came to the United States in the 1700's from Germany.They still live in Pennsylvannia as a distinctive subculture.Account for the following gene frequencies. Gene Germany Dunkers United States M .55 .66 .54 N .45 .34 .46
|
Favourite links
|
|
| ||||||||||||||||||||
|
This page has been visited
|